Excessive intake of trans fatty acid accelerates atherosclerosis through promoting inflammation and oxidative stress in a mouse model of hyperlipidemia

Open ArchivePublished:February 19, 2017DOI:https://doi.org/10.1016/j.jjcc.2016.12.012

      Abstract

      Background

      Epidemiological studies have demonstrated that trans fatty acids (TFAs) are a risk for coronary artery disease. However, the precise mechanism underlying the proatherogenic effect of TFA has not been completely elucidated. To obtain better understanding of the impact of TFA on vascular diseases, this study investigated the effect of TFA on oxidative stress using a mouse model of atherosclerosis.

      Methods

      Low-density lipoprotein (LDL) receptor knockout mice were fed with diet containing 0.5% cholesterol (control), 0.5% cholesterol + 5% elaidic acids (Trans group), and 0.5% cholesterol + 5% oleic acids (Cis group) for 8 weeks. Atherosclerotic lesion and oxidative stress in aortic wall were evaluated. In vitro experiments using smooth muscle cells were performed to corroborate in vivo findings.

      Results

      The atherosclerotic lesion area was significantly larger in Trans group than that in control or Cis group. Lipoprotein fractionation was similar among groups, while plasma oxidized LDL level and superoxide production in the vessel wall were markedly increased in Trans group. Elaidic acids were accumulated in a variety of tissues including liver and adipose tissue, which was associated with the high level of inflammatory cytokines in these tissues and plasma. Aortic wall from Trans group showed augmented expression of reactive oxygen species and NAPDH oxidase (p22phox) in smooth muscle cells. In vitro experiments confirmed that elaidic acids upregulated expression of NADPH oxidase and inflammatory cytokines in cultured smooth muscle cells.

      Conclusion

      Excessive intake of TFA contributes to the progression of atherosclerosis by evoking inflammation and oxidative stress in mice.

      Keywords

      Introduction

      The risk of atherosclerotic cardiovascular disease is largely linked to modifiable environmental factors, including diet. Epidemiological investigations from western countries have revealed a significant positive association of cardiovascular disease with the consumption of trans fatty acids (TFAs) [
      • Ghahremanpour F.
      • Firoozrai M.
      • Darabi M.
      • Zavarei A.
      • Mohebbi A.
      Adipose tissue trans fatty acids and risk of coronary artery disease: a case-control study.
      ,
      • Lemaitre R.N.
      • King I.B.
      • Raghunathan T.E.
      • Pearce R.M.
      • Weinmann S.
      • Knopp R.H.
      • Copass M.K.
      • Cobb L.A.
      • Siscovick D.S.
      Cell membrane trans-fatty acids and the risk of primary cardiac arrest.
      ,
      • Mozaffarian D.
      • Rimm E.B.
      • King I.B.
      • Lawler R.L.
      • McDonald G.B.
      • Levy W.C.
      Trans fatty acids and systemic inflammation in heart failure.
      ]. Although intake of dietary lipids in Japan is considered to be lower than western countries, we recently reported that serum TFA concentration is elevated in patients with coronary artery disease (CAD) in Japan [
      • Mori K.
      • Ishida T.
      • Yasuda T.
      • Hasokawa M.
      • Monguchi T.
      • Sasaki M.
      • Kondo K.
      • Nakajima H.
      • Shinohara M.
      • Shinke T.
      • Irino Y.
      • Toh R.
      • Nishimura K.
      • Hirata K.
      Serum trans-fatty acid concentration is elevated in young patients with coronary artery disease in Japan.
      ].
      TFAs are unsaturated fatty acids with at least one double bond in the trans configuration. It is estimated that TFA contributed up to 4–12% of total dietary fat intake in the US population [
      • Allison D.B.
      • Egan S.K.
      • Barraj L.M.
      • Caughman C.
      • Infante M.
      • Heimbach J.T.
      Estimated intakes of trans fatty and other fatty acids in the US population.
      ]. The majority of TFA in our diet are industrially produced during the partial hydrogenation of vegetable oils, a process that converts unsaturated oils into semisolid fats for use in a variety of foods such as deep-fried fast foods, bakery products, packaged snack foods, margarines, and crackers [
      • Korver O.
      • Katan M.B.
      The elimination of trans fats from spreads: how science helped to turn an industry around.
      ,
      • Ascherio A.
      • Katan M.B.
      • Zock P.L.
      • Stampfer M.J.
      • Willett W.C.
      Trans fatty acids and coronary heart disease.
      ].
      Among all TFAs, elaidic acid (18:1 trans-9) is known as the main isomer in industrially produced TFAs. In the Seven Countries Study, a strong positive association was observed between 25-year death rates from coronary heart disease and average intake of elaidic acid [
      • Kromhout D.
      • Menotti A.
      • Bloemberg B.
      • Aravanis C.
      • Blackburn H.
      • Buzina R.
      • Dontas A.S.
      • Fidanza F.
      • Giampaoli S.
      • Jansen A.
      • et al.
      Dietary saturated and trans fatty acids and cholesterol and 25-year mortality from coronary heart disease: the Seven Countries Study.
      ]. Although observational studies indicate that TFA could accelerate atherosclerosis, there are few studies demonstrating the mechanism of dietary TFA on the development of CAD. The purpose of this study was to investigate the impact of dietary TFA on oxidative stress and development of atherosclerosis using a mouse model of hyperlipidemia.

      Materials and methods

       Materials and animal preparation

      Male low-density lipoprotein receptor-deficient mice (LDLr−/−, Jackson Laboratories, Bar Harbor, ME, USA) on a C57BL/6 genetic background at 6 weeks of age were randomly assigned to one of the following three groups: (1) fed a diet containing 0.5% (w/w) cholesterol (Control group, n = 10); (2) fed a diet containing 0.5% (w/w) cholesterol and 5% (w/w) elaidic acid (C18:1, 9-trans) (Trans group, n = 13); (3) fed a diet containing 0.5% (w/w) cholesterol and 5% (w/w) oleic acid (C18:1, 9-cis) (Cis group, n = 12). Mice were provided the diet and water ad libitum and maintained on a 12 h light/dark cycle for 8 weeks and euthanized at 14 weeks of age. All animal experiments were conducted according to the guidelines for animal experiments at Kobe University Graduate School of Medicine.

       Plasma lipids and glucose analysis

      Blood samples were taken by cardiac puncture when mice were euthanized after a 4-h fasting. Plasma levels of cholesterol and triglyceride were measured enzymatically at the Nagahama Life Science Laboratory of Oriental Yeast Co., Ltd. (Shiga, Japan). Blood glucose was measured by OneTouch Ultra glucometer (LifeScan, Wayne, PA, USA). Lipoprotein fractionation analysis was performed by high performance liquid chromatography (HPLC) (LipoSEARCH®) in the Skylight Biotech, Inc. (Akita, Japan) according to the specified procedure [
      • Usui S.
      • Nakamura M.
      • Jitsukata K.
      • Nara M.
      • Hosaki S.
      • Okazaki M.
      Assessment of between-instrument variations in a HPLC method for serum lipoproteins and its traceability to reference methods for total cholesterol and HDL-cholesterol.
      ,
      • Usui S.
      • Hara Y.
      • Hosaki S.
      • Okazaki M.
      A new on-line dual enzymatic method for simultaneous quantification of cholesterol and triglycerides in lipoproteins by HPLC.
      ].

       Blood pressure measurement

      Systolic blood pressure (SBP) was measured using a noninvasive tail-cuff blood pressure machine (BP-98, Softron, Tokyo, Japan). Conscious mice were placed on the warmed platform of the machine, which was maintained at 37 °C, and were allowed to acclimatize to the apparatus for 5 min before the start of measurement. The SBP was taken at least three times per mouse, and then the values were averaged to determine the SBP for the mouse.

       Histological analysis of atherosclerotic lesions

      Mice were euthanized at the age of 14 weeks and the atherosclerotic lesions were analyzed as described previously [
      • Takaya T.
      • Kawashima S.
      • Shinohara M.
      • Yamashita T.
      • Toh R.
      • Sasaki N.
      • Inoue N.
      • Hirata K.
      • Yokoyama M.
      Angiotensin II type 1 receptor blocker telmisartan suppresses superoxide production and reduces atherosclerotic lesion formation in apolipoprotein E-deficient mice.
      ]. The aortic samples were fixed in 4% paraformaldehyde, embedded in OCT compound (Tissue-Tek, Sakura Finetek, Tokyo, Japan), and sectioned (10-μm thickness). Five consecutive sections (10-μm thickness), spanning 550 μm of the aortic root, were collected from each mouse and stained with Masson trichrome (MT), Elastica van Gieson (EVG), and Oil Red O. For quantitative analysis of atherosclerosis, the total lesion area of five sections from each mouse was measured with Image J (US National Institutes of Health, Bethesda, MD,USA) as reported previously [
      • Ishida T.
      • Kundu R.K.
      • Yang E.
      • Hirata K.
      • Ho Y.D.
      • Quertermous T.
      Targeted disruption of endothelial cell-selective adhesion molecule inhibits angiogenic processes in vitro and in vivo.
      ].

       Immunohistochemistry

      Immunohistochemical staining with MOMA-2 (BMA Biomedicals, Augst, Switzerland) of atherosclerotic lesion at the aortic sinus was performed by the labeled streptavidin biotin method as described previously [
      • Takaya T.
      • Kawashima S.
      • Shinohara M.
      • Yamashita T.
      • Toh R.
      • Sasaki N.
      • Inoue N.
      • Hirata K.
      • Yokoyama M.
      Angiotensin II type 1 receptor blocker telmisartan suppresses superoxide production and reduces atherosclerotic lesion formation in apolipoprotein E-deficient mice.
      ]. Quantitative analysis of MOMA-2-immunostaining was shown as a percentage of the positive-stained area in the total atherosclerotic lesion area. Smooth muscle actin (SMA) was stained using anti-SMA-FITC conjugated antibody (Sigma).

       Quantitative real-time polymerase chain reaction

      Total RNA was extracted from samples of murine aorta, liver, and fat. Quantitative real-time polymerase chain reaction (PCR) was performed as previously reported [
      • Hara T.
      • Ishida T.
      • Cangara H.M.
      • Hirata K.
      Endothelial cell-selective adhesion molecule regulates albuminuria in diabetic nephropathy.
      ]. Glyceradehyde-3-phosphate dehydrogenase (GAPDH) was used for normalization. The nucleotide sequences of the primers used are shown in Table 1.
      Table 1Primers for quantitative real-time PCR.
      GeneForward primer (5′-3′)Reverse primer (5′-3′)
      Mouse GAPDHTGTGTCCGTCGTGGATCTGATTGCTGTTGAAGTCGCAGGAG
      Mouse IL-1βTCCAGGATGAGGACATGAGCACGAACGTCACACACCAGCAGGTTA
      Mouse TNFαACGGCATGGATCTCAAAGACAGATAGCAAATCGGCTGACG
      Rat GAPDHAACCCATCACCATCTTCCAGGGGGGCATCAGCGGAAGG
      Rat p22phoxCCAATTCCAGTGACAGATGAGGGGAGCAACACCTTGGAAAC
      GADPH, glyceradehyde-3-phosphate dehydrogenase; IL-1β, INTERLEUKIN-1 beta; TNFα, tumor necrosis factor alpha.

       Detection of superoxide by in situ dihydroethidium method

      Dihydroethidium (DHE, Molecular Probes, Eugene, OR, USA), a superoxide sensitive fluorescent dye, was used to detect superoxide in aorta as previously reported [
      • Sun L.
      • Ishida T.
      • Yasuda T.
      • Kojima Y.
      • Honjo T.
      • Yamamoto Y.
      • Yamamoto H.
      • Ishibashi S.
      • Hirata K.
      • Hayashi Y.
      RAGE mediates oxidized LDL-induced pro-inflammatory effects and atherosclerosis in non-diabetic LDL receptor-deficient mice.
      ]. Briefly, fresh unfixed segment of aorta was made into sections and incubated with 2 μmol/L DHE in a light-protected chamber at 37 °C for 30 min. Sections were visualized with a fluorescence microscope (BZ-8000, KEYENCE, Osaka, Japan), and fluorescence intensities were quantified.

       Fatty acid analysis with gas chromatography/mass spectrometry

      Nonadecanoic acid (C19:0) was added as an internal standard to each plasma sample (50 μL), followed by total fatty acid extraction, methylester derivatization, and purification using the fatty acid methylation/purification kit (Nacalai Tesque, Inc., Kyoto, Japan) according to the manufacturer's instructions. The methylester-derivatized fatty acid after purification was reconstituted with 100 μL of hexane for subsequent analysis. Fatty acids were analyzed using a gas chromatography/mass spectrometry (QP2010 Ultra, Shimadzu Co., Kyoto, Japan). The capillary column used for fatty acid separation was SP-2650 (100 m length × 0.25 mm inner diameter × 0.20 μm film thickness, Sigma–Aldrich, St Louis, MO, USA). The column oven temperature was elevated from 140 °C to 240 °C, and the separated fatty acid methylester was detected using mass spectrometry. The standard mixture of methylester fatty acids was obtained from Sigma–Aldrich.

       Analysis of cytokines and oxidized LDL in plasma

      Plasma levels of cytokines were measured using a Q-Plex™ Mouse Cytokine Arraykit (Quansys Bioscience, Logan, UT, USA) according to the manufacturer's instructions as previously reported [
      • Hara T.
      • Ishida T.
      • Kojima Y.
      • Tanaka H.
      • Yasuda T.
      • Shinohara M.
      • Toh R.
      • Hirata K.
      Targeted deletion of endothelial lipase increases HDL particles with anti-inflammatory properties both in vitro and in vivo.
      ]. Plasma levels of oxidized LDL were measured enzymatically using a commercially available kit (Wuhan EIAab Science, Wuhan, China) according to the manufacturer's instructions.

       Statistical analysis

      The results are expressed as mean ± SE. The assumption of normality was tested using KS normality test. Statistical comparisons between two groups were evaluated by the Mann–Whitney U test, and by the Kruskal–Wallis test for multiple groups followed by the Dunn's post-test for nonparametric values. One-way ANOVA for parametric value was used followed by the Tukey's post-test. The level of statistical significance was set at p < 0.05 (GraphPad Prism; GraphPad Software Inc., La Jolla, CA, USA).

      Results

       Excessive intake of TFA accelerated atherosclerosis

      After 8 weeks on each diet, at the age of 14 week, atherosclerotic lesion formation was evaluated by oil-red O staining of sections at the level of the aortic sinus. We confirmed that plasma elaidic acid or oleic acid levels were markedly increased in Trans or Cis groups, respectively (Table 2). Trans group presented the largest amount of atherosclerotic plaque area among the three mouse groups (Fig. 1A and B). Moreover, immunohistochemical staining of atherosclerotic area was performed with MOMA-2 antibody, which represents the area containing infiltrated macrophages. The MOMA-2-immunostained area in Trans group was significantly larger (Fig. 1A and C) compared with those in Control or Cis groups. These results indicate that dietary TFA accelerated atherosclerotic lesion formation.
      Table 2Blood pressure, body weight, and plasma lipid profile in mice fed with TFA- or CFA-rich diet.
      ControlTFACFA
      Systolic blood pressure (mmHg)112.9 ± 7.1101.9 ± 5.3120.3 ± 7.9
      Diastolic blood pressure (mmHg)50.7 ± 5.655.6 ± 5.851.7 ± 5.8
      Body weight (g)23.9 ± 0.625.0 ± 0.624.1 ± 0.5
      Oleic acid (μM)3852 ± 346.43454 ± 225.05039 ± 347.2
      p<0.05 vs. control (n=22–25 in each group).
      Elaidic acid (μM)10.38 ± 1.282651 ± 199.0
      p<0.05 vs. control (n=22–25 in each group).
      14.45 ± 1.73
      Cholesterol (mg/dl)586.8 ± 56.7554.4± 21.1655.2 ± 54.9
      Triglyceride (mg/dl)45.0 ± 3.962.4 ± 4.4
      p<0.05 vs. control (n=22–25 in each group).
      70.8± 5.4
      p<0.05 vs. control (n=22–25 in each group).
      Fasting blood glucose (mg/dl)129.0 ± 13.7119.2 ± 15.8122.7± 18.2
      There was no significant difference in body weight, blood pressure, plasma cholesterol, and blood glucose concentration between 3 groups. Plasma TFA levels were measured using a gas chromatography/mass spectrometry (GC/MS QP2010 Ultra; Shimadzu Corporation). The high fatty acid diets increased plasma triglyceride concentration. Values are expressed as the mean ± SE. CFA, Cis fatty acid.
      * p < 0.05 vs. control (n = 22–25 in each group).
      Figure thumbnail gr1
      Fig. 1Atherosclerotic lesions in the aortic sinus. Low-density lipoprotein receptor −/− mice were fed normal chow diet containing 0.5% (w/w) cholesterol (control), a diet containing 0.5% (w/w) cholesterol and trans-fatty acid [Trans Group, 5% (w/w) elaidic acid], or a diet containing 0.5% (w/w) cholesterol and cis-fatty acid [Cis Group, 5% (w/w) oleic acid] for 8 weeks. (A) Oil red O staining (top) and immunohistochemistry for monocyte/macrophage marker MOMA-2 (bottom) are shown. Trans group showed significant larger area of atherosclerotic lesion and accumulation of macrophages than other groups. Values are expressed as the mean ± SE. *p < 0.05 (n = 10–13 in each group). MT, Masson's trichrome; EVG, Elastica van Gieson.

       Plasma oxidized LDL was increased by dietary TFA

      Mice in the three groups at 14 weeks of age had comparable body weight, blood pressure, and blood glucose levels, while Trans and Cis groups had significantly higher triglyceride levels than Control group (Table 2). To investigate the mechanism whereby atherosclerosis was accelerated by dietary TFA, plasma lipid profiles from the three groups were evaluated. In plasma, elaidic acid was comparably distributed in the very low-density lipoprotein (VLDL), LDL, and high-density lipoprotein (HDL) fractions, while it was also present in the lipoprotein-depleted serum (Suppl. Fig. 1). Plasma total cholesterol levels did not differ among the three groups (Table 2). Interestingly, we observed increased plasma oxidized LDL levels in Trans group (Fig. 2A), suggesting increased oxidative stress in Trans group. HPLC analysis revealed that there were no differences in LDL/VLDL- or HDL-cholesterol levels (Fig. 2B).
      Figure thumbnail gr2
      Fig. 2Plasma lipoprotein profile and oxidized LDL levels in mice. (A) Plasma concentration of oxidized LDL was measured by enzyme-linked immunosorbent assay. The mice fed with trans fatty acids-rich diet showed a significant increase in oxidized LDL levels. (B) Plasma lipoprotein profile was evaluated by high performance liquid chromatography. Lipoprotein fractionation was similar among groups. Values are expressed as the mean ± SE. *p < 0.05, **p < 0.01 (n = 5–6 in each group). CM, chylomicron; VLDL, very low-density lipoprotein; LDL, low-density lipoprotein; HDL, high-density lipoprotein; TG, triglyceride.

       TFA induced inflammation and oxidative stress

      We confirmed the increased level of elaidic acids in each tissue (aorta, liver, and spleen) in Trans group (Table 3). To determine whether TFA causes inflammatory response in various tissues, we examined the plasma and tissue levels of inflammatory cytokines. Plasma TNF-α and IL-1β protein concentrations in Trans group were significantly higher than those in Control and Cis groups (Fig. 3A). We then analyzed tumor necrosis factor (TNF)-α or interleukin (IL)-1β mRNA levels in the aorta, liver, and adipose tissue. Real-time PCR revealed that TNF-α mRNA levels in aorta and liver and IL-1β levels in fat from Trans group were significantly higher compared with those from Control and Cis groups (Fig. 3B–D). These findings indicate that excessive intake of TFA induces inflammation not only in plasma but also in various tissues.
      Table 3Elaidic acid levels in mice fed with control-, TFA-rich-, or CFA-rich diet.
      ControlTFACFA
      Plasma (μM)4.439 ± 1.282651 ± 199
      p<0.0001 vs. control (n=5–7 in each group).
      5.984 ± 1.723
      Aorta (μmol/mg)2.447 ± 0.42186.1 ± 20.5
      p<0.0001 vs. control (n=5–7 in each group).
      2.898 ± 0.38
      Liver (μmol/mg)3.542 ± 0.65461.0 ± 42.5
      p<0.0001 vs. control (n=5–7 in each group).
      17.98 ± 2.33
      Adipose tissue (μmol/mg)24.09 ± 6.097704 ± 851.2
      p<0.0001 vs. control (n=5–7 in each group).
      33.05 ± 4.15
      Elaidic acid concentrations in plasma and tissue lysates were analyzed using GC/MS. In Trans group, elaidic acids were significantly increased in plasma, and accumulated in a variety of tissues. Values are expressed as the mean ± SD.
      * p < 0.0001 vs. control (n = 5–7 in each group).
      Figure thumbnail gr3
      Fig. 3Plasma and tissue inflammatory cytokine levels in mice. (A) Plasma cytokine levels were detected by sandwich enzyme-linked immunosorbent assay. (B) Cytokines in aorta, (C) liver, and (D) adipose tissue were detected by real-time polymerase chain reaction. Levels of inflammatory cytokines such as TNF-α and IL-1β were significantly higher in the Trans group than those in control or Cis group. Values are expressed as the mean ± SE. *p < 0.05, **p < 0.01, ***p < 0.001 (n = 12–14 in each group). TNF, tumor necrosis factor; IL, interleukin.
      Because inflammation is a trigger of oxidative stress, we investigated the effect of TFA on superoxide production in aortic vessel wall. The DHE staining revealed that Trans group exhibited a marked acceleration in aortic superoxide production compared with Control or Cis group (Fig. 4A and B). We investigated the expression of NADPH oxidase, which is a major pathway for superoxide production. As shown in Fig. 4C, the TFA treatment significantly increased the expression of NADPH oxidase subunits p22phox in the vascular wall. Fig. 4D reveals that DHE signal shows similar localization pattern with vascular smooth muscle cells, which derived us to focus and examine the effect of TFA in cultured smooth muscle cells.
      Figure thumbnail gr4
      Fig. 4TFA increased reactive oxygen species production in mouse aorta. Dihydroethidium (DHE), a superoxide sensitive fluorescent dye, was used to detect superoxide in ascending aorta. (A) In situ detection of superoxide by DHE stain (top panels, original magnification, ×40; bottom panels, original magnification, ×400). Scale bar = 100 μm. (B) The mean fluorescence intensity in the high-power field was quantified and expressed as values for control. (C) Expression of p22phox was evaluated by real time-polymerase chain reaction. Values are expressed as the mean ± SE. *p < 0.05, **p < 0.01, ****p < 0.0001. Trans group exhibited a marked acceleration in aortic superoxide production compared with Control and Cis groups. (D) Staining of smooth muscle actin (SMA) demonstrates similar localization in aortic wall. Scale bar = 10 μm. DAPI, 4′,6-diamidino-2-phenylindole.

       TFA increased superoxide production and inflammatory cytokines in vascular smooth muscle cells

      We stimulated cultured smooth muscle cells with elaidic and oleic acid and control, and evaluated the superoxide production by DHE staining. Elaidic acid evoked oxidative stress compared to oleic acid (Fig. 5A and C). TFA-induced superoxide production was inhibited by NADPH oxidase inhibitor, DPI (Fig. 5B). We observed that elaidic acid upregulated the expression level of p22phox compared to oleic acid or control as observed in vivo experiments (Fig. 5D). Expression levels of TNF-α demonstrated a similar pattern (Fig. 5E). These findings indicate that TFA increased oxidative stress by upregulation of NADPH oxidase and inflammatory cytokines in smooth muscle cells.
      Figure thumbnail gr5
      Fig. 5TFA increased NADPH oxidase and oxidative stress in cultured smooth muscle cells. (A–C) Rat vascular smooth muscle cells were treated with vehicle (Control), elaidic acid (trans-fatty acid, Trans Group, 100 μmol/L), or oleic acid (cis-fatty acid, Cis Group, 100 μmol/L) for 24 h. In situ detection of superoxide by dihydroethidium stain (original magnification, ×200). NADPH oxidase inhibitor, diphenyleneiodonium (DPI) inhibited TFA-induced ROS production. Each experiment was repeated three times. (D) Expression of p22phox was evaluated by real time-polymerase chain reaction. (E) Expression level of TNF-alpha was increased by TFA treatment in smooth muscle cells. *p < 0.05, **p < 0.01, ***p < 0.001 vs. C (n = 3–6 in each group). Values are expressed as the mean ± SE. Scale bar = 100 μm. TFA, trans fatty acid; DAPI, 4′,6-diamidino-2-phenylindole; DHE, dihydroethidium; TNF, tumor necrosis factor.

      Discussion

      In the present study, we demonstrated that (1) excessive intake of TFA accelerated atherosclerotic lesion formation, inflammatory cytokines, and oxidative stress in mice, (2) plasma oxidized LDL was increased by TFA, (3) TFA treatment induced oxidative stress and inflammatory cytokines in vascular smooth muscle cells in vitro. The adverse effects of TFA have been generally explained by worsening plasma lipid profiles. In fact, over-consumption of TFA induces elevation of plasma levels of total- and LDL-cholesterol, while decreases HDL-cholesterol. This effect is greater when compared with the consumption of equal amounts of calories from saturated or cis unsaturated fats [
      • Ascherio A.
      • Katan M.B.
      • Zock P.L.
      • Stampfer M.J.
      • Willett W.C.
      Trans fatty acids and coronary heart disease.
      ,
      • Nelson G.J.
      Dietary fat, trans fatty acids, and risk of coronary heart disease.
      ,
      • Mozaffarian D.
      • Katan M.B.
      • Ascherio A.
      • Stampfer M.J.
      • Willett W.C.
      Trans fatty acids and cardiovascular disease.
      ]. In the present study, dietary TFA increased plasma triglyceride levels but did not affect plasma total- and LDL-cholesterol levels, which is in agreement with a previous report [
      • Cassagno N.
      • Palos-Pinto A.
      • Costet P.
      • Breilh D.
      • Darmon M.
      • Berard A.M.
      Low amounts of trans 18:1 fatty acids elevate plasma triacylglycerols but not cholesterol and alter the cellular defence to oxidative stress in mice.
      ]. The reason for the lack of the LDL-raising effect by TFA in mice remains unclear, but may be explained by the species difference of lipid metabolism between humans and mice including lack of cholesteryl ester transfer protein (CETP) activity in mice. A past report showed TFA raises LDL-cholesterol via upregulating CETP activity [
      • Vendel Nielsen L.
      • Krogager T.P.
      • Young C.
      • Ferreri C.
      • Chatgilialoglu C.
      • Norregaard Jensen O.
      • Enghild J.J.
      Effects of elaidic acid on lipid metabolism in HepG2 cells, investigated by an integrated approach of lipidomics, transcriptomics and proteomics.
      ]. On the other hand, it has been postulated that TFA has direct adverse effects on the vessel wall beyond its impact on plasma lipid profile [
      • Mensink R.P.
      • Zock P.L.
      • Kester A.D.
      • Katan M.B.
      Effects of dietary fatty acids and carbohydrates on the ratio of serum total to HDL cholesterol and on serum lipids and apolipoproteins: a meta-analysis of 60 controlled trials.
      ]. Lack of LDL-cholesterol raising after TFA treatment in mice enabled us to examine the direct molecular mechanisms of TFA in vascular wall beyond modifying lipid profile.
      The present study has shown that dietary TFA intake markedly increased plasma oxidized LDL levels, supporting that TFA worsens quality of the plasma lipids.
      We have shown that dietary TFA accumulated abundantly in plasma and various tissues, which was associated with systemic and local inflammatory responses. Previous studies have reported that TFA consumption has adverse effects on systemic inflammatory markers. Dietary TFA consumption increased plasma levels of TNF receptor in healthy women and IL-6 and C-reactive protein (CRP) in women with higher body mass index [
      • Mozaffarian D.
      • Pischon T.
      • Hankinson S.E.
      • Rifai N.
      • Joshipura K.
      • Willett W.C.
      • Rimm E.B.
      Dietary intake of trans fatty acids and systemic inflammation in women.
      ]. In a crossover trial, consumption of TFA increased plasma levels of IL-6 and CRP compared with oleic acid [
      • Baer D.J.
      • Judd J.T.
      • Clevidence B.A.
      • Tracy R.P.
      Dietary fatty acids affect plasma markers of inflammation in healthy men fed controlled diets: a randomized crossover study.
      ], indicating that TFAs are more pro-inflammatory than cis unsaturated fatty acid. These pro-inflammatory effects of TFA can account at least in part for the pathogenesis of the atherosclerotic lesion development.
      It has been reported that fatty acids can modulate the susceptibility of oxidative stress, probably due to changes of fatty acid composition in cell membrane [
      • Mozaffarian D.
      • Pischon T.
      • Hankinson S.E.
      • Rifai N.
      • Joshipura K.
      • Willett W.C.
      • Rimm E.B.
      Dietary intake of trans fatty acids and systemic inflammation in women.
      ]. Furthermore, inflammation-triggered oxidative stress has a fundamental impact on the development of atherosclerosis. In the present study, elaidic acid increased superoxide production in aortic vessel wall and cultured smooth muscle cells, which is consistent with previous reports [
      • Iwata N.G.
      • Pham M.
      • Rizzo N.O.
      • Cheng A.M.
      • Maloney E.
      • Kim F.
      Trans fatty acids induce vascular inflammation and reduce vascular nitric oxide production in endothelial cells.
      ]. Moreover, it is reported that elaidic acid dose-dependently increases reactive oxygen species production in endothelial cells, resulting in apoptotic cell death [
      • Iwata N.G.
      • Pham M.
      • Rizzo N.O.
      • Cheng A.M.
      • Maloney E.
      • Kim F.
      Trans fatty acids induce vascular inflammation and reduce vascular nitric oxide production in endothelial cells.
      ]. Elaidic acid-rich diet increased a plasma marker of oxidative stress, F2-isoprostane level in mice [
      • Mensink R.P.
      • Zock P.L.
      • Kester A.D.
      • Katan M.B.
      Effects of dietary fatty acids and carbohydrates on the ratio of serum total to HDL cholesterol and on serum lipids and apolipoproteins: a meta-analysis of 60 controlled trials.
      ]. Moreover, feeding rats with high TFA-containing diet induced oxidative stress in the liver, resulting in the development of non-alcoholic fatty liver disease [
      • Dhibi M.
      • Brahmi F.
      • Mnari A.
      • Houas Z.
      • Chargui I.
      • Bchir L.
      • Gazzah N.
      • Alsaif M.A.
      • Hammami M.
      The intake of high fat diet with different trans fatty acid levels differentially induces oxidative stress and non alcoholic fatty liver disease (NAFLD) in rats.
      ]. We have shown that elaidic acid upregulates NADPH oxidase component p22phox and NOX1. From these findings, we infer that dietary TFA accumulates in plasma and various tissues and directly promotes inflammation and oxidative stress. It is known that there is complex molecular interaction between inflammation and oxidative stress, which are not fully elucidated yet [
      • Morgan M.J.
      • Liu Z.G.
      Crosstalk of reactive oxygen species and NF-kappaB signaling.
      ,
      • Bakunina N.
      • Pariante C.M.
      • Zunszain P.A.
      Immune mechanisms linked to depression via oxidative stress and neuroprogression.
      ,
      • Koyama T.
      • Watanabe H.
      • Ito H.
      The association of circulating inflammatory and oxidative stress biomarker levels with diagonal earlobe crease in patients with atherosclerotic diseases.
      ,
      • Yamashita T.
      • Sasaki N.
      • Kasahara K.
      • Hirata K.
      Anti-inflammatory and immune-modulatory therapies for preventing atherosclerotic cardiovascular disease.
      ]. TFA is likely involved in this cross talk.
      TFA seems to have diverse actions on cellular components of the arterial wall. Elaidic acid has been reported to promote thrombus formation in mice by aggravating anti-thrombogenic endothelial functions [
      • Kondo K.
      • Ishida T.
      • Yasuda T.
      • Nakajima H.
      • Mori K.
      • Tanaka N.
      • Mori T.
      • Monguchi T.
      • Shinohara M.
      • Irino Y.
      • Toh R.
      • Rikitake Y.
      • Kiyomizu K.
      • Tomiyama Y.
      • Yamamoto J.
      • et al.
      Trans-fatty acid promotes thrombus formation in mice by aggravating antithrombogenic endothelial functions via Toll-like receptors.
      ]. As for the underlying mechanisms, we have recently demonstrated that elaidic acid increases phosphorylation of NFκB protein by activation of toll-like receptors in cultured endothelial cells [
      • Kondo K.
      • Ishida T.
      • Yasuda T.
      • Nakajima H.
      • Mori K.
      • Tanaka N.
      • Mori T.
      • Monguchi T.
      • Shinohara M.
      • Irino Y.
      • Toh R.
      • Rikitake Y.
      • Kiyomizu K.
      • Tomiyama Y.
      • Yamamoto J.
      • et al.
      Trans-fatty acid promotes thrombus formation in mice by aggravating antithrombogenic endothelial functions via Toll-like receptors.
      ]. Thus, we have expanded the direct action of TFA to smooth muscle cells. Taken together, these unfavorable actions of TFA on all types of vascular cells, as a whole, are likely to contribute to accelerated atherosclerotic development. In this context, the present study has provided a novel insight regarding the pro-atherogenic effects of TFA.

      Funding

      This work was supported by Grants-In-Aid for Scientific Research from the Ministry of Education, Culture, Sports, Science and Technology of Japan, and by Grants-in-Aid from the Cabinet Office Food Safety Commission of Japan .

      Disclosure

      The authors have no conflicts of interest that are directly relevant to the content of this study.

      Acknowledgments

      We would like to thank Emiko Yoshida for technical assistance.

      Appendix A. Supplementary data

      The following are the supplementary data to this article:

      References

        • Ghahremanpour F.
        • Firoozrai M.
        • Darabi M.
        • Zavarei A.
        • Mohebbi A.
        Adipose tissue trans fatty acids and risk of coronary artery disease: a case-control study.
        Ann Nutr Metab. 2008; 52: 24-28
        • Lemaitre R.N.
        • King I.B.
        • Raghunathan T.E.
        • Pearce R.M.
        • Weinmann S.
        • Knopp R.H.
        • Copass M.K.
        • Cobb L.A.
        • Siscovick D.S.
        Cell membrane trans-fatty acids and the risk of primary cardiac arrest.
        Circulation. 2002; 105: 697-701
        • Mozaffarian D.
        • Rimm E.B.
        • King I.B.
        • Lawler R.L.
        • McDonald G.B.
        • Levy W.C.
        Trans fatty acids and systemic inflammation in heart failure.
        Am J Clin Nutr. 2004; 80: 1521-1525
        • Mori K.
        • Ishida T.
        • Yasuda T.
        • Hasokawa M.
        • Monguchi T.
        • Sasaki M.
        • Kondo K.
        • Nakajima H.
        • Shinohara M.
        • Shinke T.
        • Irino Y.
        • Toh R.
        • Nishimura K.
        • Hirata K.
        Serum trans-fatty acid concentration is elevated in young patients with coronary artery disease in Japan.
        Circ J. 2015; 79: 2017-2025
        • Allison D.B.
        • Egan S.K.
        • Barraj L.M.
        • Caughman C.
        • Infante M.
        • Heimbach J.T.
        Estimated intakes of trans fatty and other fatty acids in the US population.
        J Am Diet Assoc. 1999; 99: 166-174
        • Korver O.
        • Katan M.B.
        The elimination of trans fats from spreads: how science helped to turn an industry around.
        Nutr Rev. 2006; 64: 275-279
        • Ascherio A.
        • Katan M.B.
        • Zock P.L.
        • Stampfer M.J.
        • Willett W.C.
        Trans fatty acids and coronary heart disease.
        N Engl J Med. 1999; 340: 1994-1998
        • Kromhout D.
        • Menotti A.
        • Bloemberg B.
        • Aravanis C.
        • Blackburn H.
        • Buzina R.
        • Dontas A.S.
        • Fidanza F.
        • Giampaoli S.
        • Jansen A.
        • et al.
        Dietary saturated and trans fatty acids and cholesterol and 25-year mortality from coronary heart disease: the Seven Countries Study.
        Prev Med. 1995; 24: 308-315
        • Usui S.
        • Nakamura M.
        • Jitsukata K.
        • Nara M.
        • Hosaki S.
        • Okazaki M.
        Assessment of between-instrument variations in a HPLC method for serum lipoproteins and its traceability to reference methods for total cholesterol and HDL-cholesterol.
        Clin Chem. 2000; 46: 63-72
        • Usui S.
        • Hara Y.
        • Hosaki S.
        • Okazaki M.
        A new on-line dual enzymatic method for simultaneous quantification of cholesterol and triglycerides in lipoproteins by HPLC.
        J Lipid Res. 2002; 43: 805-814
        • Takaya T.
        • Kawashima S.
        • Shinohara M.
        • Yamashita T.
        • Toh R.
        • Sasaki N.
        • Inoue N.
        • Hirata K.
        • Yokoyama M.
        Angiotensin II type 1 receptor blocker telmisartan suppresses superoxide production and reduces atherosclerotic lesion formation in apolipoprotein E-deficient mice.
        Atherosclerosis. 2006; 186: 402-410
        • Ishida T.
        • Kundu R.K.
        • Yang E.
        • Hirata K.
        • Ho Y.D.
        • Quertermous T.
        Targeted disruption of endothelial cell-selective adhesion molecule inhibits angiogenic processes in vitro and in vivo.
        J Biol Chem. 2003; 278: 34598-34604
        • Hara T.
        • Ishida T.
        • Cangara H.M.
        • Hirata K.
        Endothelial cell-selective adhesion molecule regulates albuminuria in diabetic nephropathy.
        Microvasc Res. 2009; 77: 348-355
        • Sun L.
        • Ishida T.
        • Yasuda T.
        • Kojima Y.
        • Honjo T.
        • Yamamoto Y.
        • Yamamoto H.
        • Ishibashi S.
        • Hirata K.
        • Hayashi Y.
        RAGE mediates oxidized LDL-induced pro-inflammatory effects and atherosclerosis in non-diabetic LDL receptor-deficient mice.
        Cardiovasc Res. 2009; 82: 371-381
        • Hara T.
        • Ishida T.
        • Kojima Y.
        • Tanaka H.
        • Yasuda T.
        • Shinohara M.
        • Toh R.
        • Hirata K.
        Targeted deletion of endothelial lipase increases HDL particles with anti-inflammatory properties both in vitro and in vivo.
        J Lipid Res. 2011; 52: 57-67
        • Nelson G.J.
        Dietary fat, trans fatty acids, and risk of coronary heart disease.
        Nutr Rev. 1998; 56: 250-252
        • Mozaffarian D.
        • Katan M.B.
        • Ascherio A.
        • Stampfer M.J.
        • Willett W.C.
        Trans fatty acids and cardiovascular disease.
        N Engl J Med. 2006; 354: 1601-1613
        • Cassagno N.
        • Palos-Pinto A.
        • Costet P.
        • Breilh D.
        • Darmon M.
        • Berard A.M.
        Low amounts of trans 18:1 fatty acids elevate plasma triacylglycerols but not cholesterol and alter the cellular defence to oxidative stress in mice.
        Br J Nutr. 2005; 94: 346-352
        • Vendel Nielsen L.
        • Krogager T.P.
        • Young C.
        • Ferreri C.
        • Chatgilialoglu C.
        • Norregaard Jensen O.
        • Enghild J.J.
        Effects of elaidic acid on lipid metabolism in HepG2 cells, investigated by an integrated approach of lipidomics, transcriptomics and proteomics.
        PLoS One. 2013; 8: e74283
        • Mensink R.P.
        • Zock P.L.
        • Kester A.D.
        • Katan M.B.
        Effects of dietary fatty acids and carbohydrates on the ratio of serum total to HDL cholesterol and on serum lipids and apolipoproteins: a meta-analysis of 60 controlled trials.
        Am J Clin Nutr. 2003; 77: 1146-1155
        • Mozaffarian D.
        • Pischon T.
        • Hankinson S.E.
        • Rifai N.
        • Joshipura K.
        • Willett W.C.
        • Rimm E.B.
        Dietary intake of trans fatty acids and systemic inflammation in women.
        Am J Clin Nutr. 2004; 79: 606-612
        • Baer D.J.
        • Judd J.T.
        • Clevidence B.A.
        • Tracy R.P.
        Dietary fatty acids affect plasma markers of inflammation in healthy men fed controlled diets: a randomized crossover study.
        Am J Clin Nutr. 2004; 79: 969-973
        • Iwata N.G.
        • Pham M.
        • Rizzo N.O.
        • Cheng A.M.
        • Maloney E.
        • Kim F.
        Trans fatty acids induce vascular inflammation and reduce vascular nitric oxide production in endothelial cells.
        PLoS One. 2011; 6: e29600
        • Dhibi M.
        • Brahmi F.
        • Mnari A.
        • Houas Z.
        • Chargui I.
        • Bchir L.
        • Gazzah N.
        • Alsaif M.A.
        • Hammami M.
        The intake of high fat diet with different trans fatty acid levels differentially induces oxidative stress and non alcoholic fatty liver disease (NAFLD) in rats.
        Nutr Metab (Lond). 2011; 8: 65
        • Morgan M.J.
        • Liu Z.G.
        Crosstalk of reactive oxygen species and NF-kappaB signaling.
        Cell Res. 2011; 21: 103-115
        • Bakunina N.
        • Pariante C.M.
        • Zunszain P.A.
        Immune mechanisms linked to depression via oxidative stress and neuroprogression.
        Immunology. 2015; ([Epub ahead of print; Jan 10])https://doi.org/10.1111/imm.12443
        • Koyama T.
        • Watanabe H.
        • Ito H.
        The association of circulating inflammatory and oxidative stress biomarker levels with diagonal earlobe crease in patients with atherosclerotic diseases.
        J Cardiol. 2016; 67: 347-351
        • Yamashita T.
        • Sasaki N.
        • Kasahara K.
        • Hirata K.
        Anti-inflammatory and immune-modulatory therapies for preventing atherosclerotic cardiovascular disease.
        J Cardiol. 2015; 66: 1-8
        • Kondo K.
        • Ishida T.
        • Yasuda T.
        • Nakajima H.
        • Mori K.
        • Tanaka N.
        • Mori T.
        • Monguchi T.
        • Shinohara M.
        • Irino Y.
        • Toh R.
        • Rikitake Y.
        • Kiyomizu K.
        • Tomiyama Y.
        • Yamamoto J.
        • et al.
        Trans-fatty acid promotes thrombus formation in mice by aggravating antithrombogenic endothelial functions via Toll-like receptors.
        Mol Nutr Food Res. 2015; 59: 729-740